رونویسی DNA به RNA

ساخته‌شدن RNA از روی DNA را رونویسی می‌گویند که نخستین گام برای ساخت پروتئین ها می‌باشد.

قطعه کد مربوط به رونویسی RNA از DNA را در ادامه مشاهده می‌کنید. تابع  dna_to_rna با دریافت dna به عنوان ورودی و جایگزینی نوکلئوتید U به جای T آنرا به RNA تبدیل کرده و نتیجه را بر‌می‌گرداند.

def dna_to_rna(dna):
    #Translates the given DNA sequence to an RNA sequence.
    return dna.replace('T', 'U')

dna = 'CTTACTGAGTACATGCCCCCTTTAATGTTAA'
# Print the answer.
print dna_to_rna(dna)

دیدگاهتان را بنویسید

نشانی ایمیل شما منتشر نخواهد شد. بخش‌های موردنیاز علامت‌گذاری شده‌اند *