ایجاد مکمل معکوس DNA

 reverse complement

مکمل معکوس یک رشته DNA با معکوس کردن رشته و گرفتن مکمل هر نماد شکل می‌گیرد. با توجه به اینکه تکثیر و رونویسی DNA از انتهای ‘۳ به انتهای ‘۵ انجام می‌پذیرد لذا بایستی انتهای ‘۳ یک رشته در مقابل انتهای ‘۵ رشته مکمل قرار گیرد.

قطعه کد مربوط به ساخت مکمل معکوس رشته DNA را در ادامه مشاهده می‌کنید. تابع  reverse_complement_dna با دریافت dna به عنوان ورودی و جایگزینی نوکلئوتیدهای A با T ، T با C ، A با G ،  G با C  و در مرحله آخر معکوس کردن رشته نتیجه را بر‌می‌گرداند.

from string import maketrans
def reverse_complement_dna(dna):
    # Returns the reverse complement of the given DNA strand.
    transtab = maketrans('ATCG', 'TAGC')
    return dna.translate(transtab)[::-1]

dna = 'CTTACTGAGTACATGCCCCCTTTAATGTTAA'
# Get the reverse complement.
rev_comp = reverse_complement_dna(dna)
# Print and save the answer.
print rev_comp

پاسخ دهید

نشانی ایمیل شما منتشر نخواهد شد. بخش‌های موردنیاز علامت‌گذاری شده‌اند *