شمارش نوکلئوتیدهای DNA

قطعه کد مربوط به شمارش نوکلئوتیدهای DNA را در بلاک زیر مشاهده می‌کنید. تابع  base_count_dna با دریافت dna به عنوان ورودی، نوکلئوتیدهای آنرا از طریق Counter شمارش کرده و نتیجه را بر‌می‌گرداند.

from collections import Counter


def base_count_dna(dna):
    #Returns the count of each base appearing in the given DNA sequence.
    base_count = Counter(dna)
    return [base_count[base] for base in 'ACGT']


dna = 'CTTACTGAGTACATGCCCCCTTTAATGTTAA'
base_count = map(str, base_count_dna(dna))

# Print the answer.
print ' '.join(base_count)

 

پاسخ دهید

نشانی ایمیل شما منتشر نخواهد شد. بخش‌های موردنیاز علامت‌گذاری شده‌اند *